>Mlig033232.g1 {REF} Mlig033232.g1 {Length: 2701} {Pfam: Zinc finger C-x8-C-x5-C-x3-H type (and similar) [PF00642.24, score=45.3]; CCCH-type zinc finger [PF18044.1, score=35.9]; RNA-binding, Nab2-type zinc finger [PF14608.6, score=24.2]; Zinc finger domain [PF18345.1, score=20.6]} {Mouse: ENSMUSG00000042851, Zc3h6, zinc finger CCCH type containing 6, [Score=48.5, Expect=1e-05]} {Smed: dd_Smed_v6_80059_0_1, dd_Smed_v6_80059_0_1, [RH, Score=95.5, Expect=5e-24]} {RNA1509_112}
GCTGACTTCACACGAGAGGGTCTGCAGCGACTCCCGACTCCTGCCGCGACTCGTGGGGAAGGCAACATCGGGCCATAGAC
ATTTCAGAGTACAGTCAGAAAAGAGCCCTTTGCTTTGTCACTATTGCCAGCGCCCTTGGATTCCCTATTAGCAAGTTCTA
GGCAAAAGGCTCGCATGATTTTTCGACCGTCAATCCAAGAGAGCCCAGATATTCACGAAAGCCTGAAAAGCGTACAAGTT
CACAAATGCAAGAATTGGCAATGGCGGACCCCGAAGGCAAAATCTGCAGGTACTTTAACACCCTCGGCGGGTGCTGGTAC
GGACAGCAGTGCAAGTTTCTGCACATCCCAAACCAAAAGCCGCCGTGCAAGTTTTTCTTCTCTGCTTCTGGCTGCCGGTT
CGGCGATGCGTGCCATTTTTCCCACGATCGCCTGCCGCTGAAGTCCGTAGAGAACGGCGCCCCCGAGTCTGAGGAGCTTC
CCAGCGAGGACATTAAGGCTGCTAGCACCGGAGCTTCTGGCGAGGGCTATCAATCGGGGACTAACAACAACAGCATGTTC
CAAACTGCCCAGCAGTTCGAAGCGCCCGAGACCGAACTGGTTGATAACGGCGTCATCTACTGTACCACGTGCCGCAAAAT
GCTGCACAGGCAGGACAACGAGAGCTATTACAATCTGCTGCGCGACCACTATCTGGAGTGCTTCTTTGAAAAGGACGCCG
AGCATATTAAAAACGTGCGCGTTCGCGCCTCGATGGAATTTGGATCGCTGTACTCGTGCAAGGTGTGCAACCTCGTGTTT
GAGAAGCCCTGGTCTCTTTTCCAGCACTGCACCGACAAGGCTATCGGCAAGGCCATAAAATCGACTCGATTCGAGCGAAA
GATGCACAACGAGTGGCTAGACGAAGTCGCTGGCTCTATGGCCGCTTACGACCTGGGCCTCTTCCCGCCAAACCAAGTCC
GGGACAGCCTGCGCGAGAATATCGCCCCGCCGGCCGTTGAGGAGGAGATTGAAACGGCCACAAACGCGCTCAACATGTGC
ATGCTGCTGAACTACATGCTCAACGGGCTTGGCATGCCGCAGGGCATCCTGCCGGCCGGCAGCGGAGGCGGCAGCGCTAG
CGGCGTCGGCGGCGGCGTCGGTGGCGGTGGCGGTGGCGGTGGCGGTGGCGGTGGCGGCGGAATGCAACGCTACCAACATG
GCCGCTCTATGAGTAGGTCGACGATGGGTGGCCGCGGTGGCGGAGGACCTCGCCGTCGGTTTGTCGGCAACTCGCAAGAT
CGAGCAGCGGCAGCTGCTGCCGCTGCTGCTGCGGCCGCTGCCGCATCTAAGACGGAGGCGACTTCGGCTCCGACTGCTGC
GGACGCTACTGCCGATCGCGCGACCGACAGTGCGACTTCGGAGACAACGACAAGCACGCTAGTGGCAATGGCCTCGGCTG
ACAAGAAGCCGGACCCGGCGAGCGGCGATGTGGAGGCCCTGCCTGCATCGCCTGACACGAGCAGCGGCAACACGTGGGGA
TTCAGCAAGGAGGAGGTTGGTGAGCTTCTGTCGCAGGGGATTAAACCGTGGGACCCGGAAGCCCCGACGGCCCTGGCTGC
TATTCGCGGCGAATTCGACTACTTGCTGAGCCAGAAAAATTCCGACTCATCGAGTGAATAAGCCCGACTGGCTGAATCAA
ATCTAGCGTGCGAAAAATTGCAGTAAACTGAGACCGAGTTAATCGCAGGAACTAAAAATCTGTTCTCTTTTCATTACCAT
TCATCATCGGCATCTTCTTTTGTTCTTCATCAAAAATCCATAGCAACGAGAAAAATATCCTATGCTCAACAGTTGCGCCT
CTGTCGCTTGTGTCGCACATTTTGATGGCTTTCCTATGAAGCTACATATATGAATAGATCGAATCCGTGTTAGTCAGAGG
CGGAGGTGGAGAGTACAATACAAATCGACAGAGCTAAGCGACAGAGTGCCGTACCATTGTTGATTGCTTCTCACCTTTGT
TTCCTGTTCCCCGGTCGAGTTTCACAAATTTTTGCCTTGGAAACGAACCGGCGATATCCGCGCGCACTAACCGAACTCCT
ATTTTTCAATATTCAGCAATCTGAAATTTTTGTTTTTGCAGACCATTTATTATTCCTTTTGTCCGCACTGGATTCGACGC
CTCTCTTGATAGCTAAAATCCGTGCAAATTTATTGACCTTACCGTTTAGAAAAATCCTATTTTAGGTTGCAGCGCATCCA
ACTGCACGAATAGATACTCACAGCAATCTTACAGGCGAAGTCGAATGCGTTTTTCGTGTCTGCAGCTCGCGCAAAGCATG
TTGCCCCACCCTCTGCTCCCGGTTTTCCTGGGTCTGCTCCATTGTCAGCCGCCGAAACCTCGGATGCAGTGCCGGCCTCC
GCTATTGTCCTTGCAATGTTTCACCCCCATCTCTTTGTTCGAAGAAAACTATATGCTTGAAAAAGCACTTTTTAGGCAGC
GTAAAGGTCGGTGGGATAATTTTGGAAGATATAAAAATGCTTATTATAACCAAGGTCTGCTAATGCACGGATGCGTGATG
TTTCGTCTGCTTACCGCAAAAGCATCACACTTTGTATGCTAAAAAGGTTTTTGTTGGCTAATTGGTGTGATTCGTTCTTT
GGTTGAACACAAGAAATAAAATAGACACAACCTTCATTCCCTTCAATTCGATGCGGCTTTAA