>Mlig016184.g1 {REF} Mlig016184.g1 {Length: 1970} {Pfam: Double-stranded RNA binding motif [PF00035.26, score=63.0]; Staufen C-terminal domain [PF16482.5, score=32.1]; double strand RNA binding domain from DEAD END PROTEIN 1 [PF14709.7, score=24.3]} {Human: ENSG00000180228, PRKRA, protein activator of interferon induced protein kinase EIF2AK2, [RH, Score=73.6, Expect=2e-14]} {Mouse: ENSMUSG00000002731, Prkra, protein kinase, interferon inducible double stranded RNA dependent activator, [RH, Score=71.6, Expect=8e-14]} {Dmel: FBgn0032515, loqs, loquacious, [Score=80.9, Expect=9e-17]} {Smed: dd_Smed_v6_9213_0_1, dd_Smed_v6_9213_0_1, [Score=67.0, Expect=2e-12]} {RNA1509_2242}
AAAAATATTTTGTTTATTTTAAGTGATTTTATTTTTGTTACAAGTTTGGGTTCCTGGTGATGATAATTGAGAGTACACGA
CTGTCACGGGTGACAAATATACGCTCGATCGTAAGAGTCAAGAGGTGACGAATGGGTAAAAGAGGTGTCAGTGCTTGAAG
GTGGATAACAGGTGTGTTGACAGATCACCCCTAGCACTCAGCTGTCACCCCTGACACTCTATCCGTCACCAGCGGGTATT
GGATGAGTTGTGAGCCATGGAATTCGCGCAAGAATGTCGCTGTAAATCGTGGGTTCGGGTTTTTCCAGCAGCTAAATAAC
ATGGGTGCATGAGAAGGATGAATCAGCGCACACTAGTAATTACACACACTCCCAGCTACACATGTTATACGACATACGAT
CGCAATACAGATTAAATAACTGCACGTACAAGTAACTACATGTATACAACTTCCCTACGGGGTGGAGCCTTCCCTCTGCT
CCTGTAATGCCCGGACCCTGGCCATTTAGTGGGAGCTGCTAATGCATGAGTAATGCCATGACCAAGATTTTTTTGAACTT
TCTATTCTATCAAGTATACAAACTATAGAAGCGAAAGAGTACATGTAATGTGAAAAAATTGTCTCTGGCAGAAAGGGTCA
GCTACTTTGCTACACCCAATTCGCAAAGCCGCATTCTGTACCAGAAATCGTAGTCTATGGCTGCTCCCTCTCTCACGGGA
GACGGTTTTGAAGAGTAAAGCTCGATTACTTGACCGCTCCTCAAGGATTCGGTTCGACCGAGCAGCGACCATCCCTCCTC
AGCAGTTCTTCTAAGCACGCGGTGTTTCTAAACGGCTCACTAATCCAACAAACACGCGATGGCCAGCAAGATTTTCTCCA
CTGCTGCGACTCTAGTTGACAAGAAGAGTGGCAAGAAGCAGCAGCAGCAAAACAAGAAGCCCGAGCAACCGATGCCGCAG
CCTCAGCCCCTGAAGCCTACCGAACCTGCCGAGAGCCTCGACGTCAAGAAGACCGACATTGTCAAGCCAGTCGAAGACAA
TCCAGTCGGTCGACTTCAAGAACTCTGCCAGCACCGACTGTGGCCGCTGCCCTCCTACACGTTCGAGTGTAGCAACGTCG
ACAATCCGAGCAAGCGCCAGTTCACCTGCACCGTGAAGCTTCAGGGTCACACCGACAGAGGCGTTGGACGCTCCAAGCAA
CTGGCTAAGCGAGCCTGCGCCCAGGCCATGCTGCAACAGTTGGCAGCCTGCACGGAAGCAAACTGCTGCCAGTCCGCCCT
GGCTGAGATCAAAAAAAGCACCGCCGGAGACGGCAACAACAAGAAGAAGGTAGCGGCGGCTGCGTCAGCTCAGCAGAAGC
CGGCAACTCCGCCGCCAAGTCCGCTGGACGAGGCCGCATTCCAAGAGTTGCGCTCGTCCAAGCGACTTCAGTCGGCTGCT
CGCGCTGGCGCCGAAGTCAATGGACTGTTCCGCGGAGTGAGAAACCGCAAGGCCGGCGTAACGCTGCCGCCTCTGGAGAC
GCCAACAGCCGGTCCCAGCAGCGCCAGCGAGCAGCTGACGGAGCTGAGCAAGCAGCACCGATTCGGGGTGCAGTTCCTTG
ACAACGGCTCCGACAACAGCAGCGGACAATACCGAGCCGTTGTCAAACTATCCACTATGCCGACTATCGTTGCTGTTAGC
AACGGAGCAAGCGTCGCCAACGCCAAGGAACAGGCTTGCCGAGCCGCCATAGAGTACCTGTGCTCTTTGACGCGAGAAAC
TACGGGACCCGCCGGCAAGAAAGCCTAGCTGTTGAACTCTTCACCCCGCTGCCCAGCGCGCTCGATTTGAAACTTAGCCA
ACTGACTGAGACTGAAGCTTATAACCTTTTAATTTCTTTAATAATGAAAATAAAAACTGCTGCCTTGCCGCTTTAAAAAA
CAAGCAGACATTTACAAATAAAAATTTCGGTTTAAACCAATAGAAATACCC