>Mlig012845.g2 {REF} Mlig012845.g2 {Length: 2367} {Pfam: RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) [PF00076.22, score=104.4]; RNA binding motif [PF08777.11, score=24.5]; Nup53/35/40-type RNA recognition motif [PF14605.6, score=19.8]} {Human: ENSG00000136450, SRSF1, serine and arginine rich splicing factor 1, [RH, Score=206, Expect=6e-66]} {Mouse: ENSMUSG00000018379, Srsf1, serine/arginine-rich splicing factor 1, [RH, Score=206, Expect=4e-66]; ENSMUSG00000098301, Srsf1, serine/arginine-rich splicing factor 1, [RH, Score=206, Expect=4e-66]} {Dmel: FBgn0283477, SF2, Splicing factor 2, [RH, Score=213, Expect=7e-69]} {Celegans: WBGene00004700, rsp-3, Probable splicing factor, arginine/serine-rich 3, [RH, Score=180, Expect=4e-56]} {Smed: dd_Smed_v6_3866_0_10, dd_Smed_v6_3866_0_10, [RH, Score=223, Expect=2e-73]} {RNA1509_15981, RNA1509_25451}
AAAGCAAATTAGACTATAATTGAAGACATTTCAAAATGCGTTTTATGTTAAGCTTTAAGCTTTTATAAAATTTAGTTTTT
TTTACTTTGAAATATTAAATTTGATGTATAATAAGTGATATTAATAATAATATTATTAAAATAATAATAATTTAATTTAA
TAATGCAAACGAGAATATGAAAAATAATAATAATATTTAAGGTAATAAATAAAGTTAATTATTCTGTTACTCTTACAACA
AATAGTTTTCTTTGCAAGCAAAATACTGCATTGACAAAAATGTTATAATGTGTAGCGGTCGGGGTGGTGCGGTGCGTGTT
TTAGGGAGACCCGTTTCGCTTTCGTAAGGAAATTGTCGGTCGTCCGTATCCGTATTCCGTATCGACGTTTAACTGTTTCA
TTATATTAAGGCATTGGTTTTTGTAAAGTGGAATAAGGTTTTATTGTTTGAATACCGCTAATCAAATCGCTGAAGCATGA
AGAAGATTTACGTTGGTAATCTGCCTCCTTCAATTCGCTCACAAGAAGTTAAGGATGTTTTCAAAAAGTATGGTCATATT
GCCAGCCTTGATCTTAAAAATAGCCGCGGTCCACCGTTTGCATTCATTGAGTACGAAGATGAACGCGACGCCGAAGATGC
TGTCAGAGGCCGCGACGGCTATAATCTAGACGGCTACAGTATTCGGGTTGAATTCCCGCGTCAAGGCGAGGGTTTTAAAC
CGCGCGGCGGTGGCGGCGGATTTGGCGGCGCCCGCGGCGGCGGAGCCCGCGGCGGAGGCCCATCGTCGAGGCGCGGCGAG
TTCAGGGTGACGGTGAGCGGCCTGCCGGCTGGAGCATCCTGGCAGGATCTCAAAGATCACATGCGCTCTGCTGGCGATGT
TGGATTTGCTGACGTGCGTAACGGCATTGGCTTTGTGGAATTTATGCGCTACGAGGATATGAAAGCGGCTATACGCAAAC
TTGACGATTCTAAGCTGCGCTCGCATCAGGGCGAATCCGGCTACATCCGGGTCAAAGAGGATCGTCCCGGCGGCGGAGGC
GCCGGTCGATCGCCTTCGCGTTCGGCTTCTCGGTCCCGATCGAGGTCCCGATCGAGGTCCCGCTCAAGGTCCCGGTCGCC
TCCGCCGCGTCGCCGGGCCTCGCCAACTTATTCGCCGATGCGCGACGGGCAGTCGCGGTCGCGTTCTCGCAGTCGCAGCC
GTTCTTAGAGCTGTCGAGTGCTGCTGTGCTATTTAACAACTTGAACTTTTTTTGTCGGGCGATCTCTGTTGGTTAGCGTG
TGTTTTTCTGCAGGTAGGTTTTTTATTCTGAATGTTTTTAGTGCTGGTTTGCTGTGTTGTCTGTTTCTAATAATCCTTTT
TTATGTTTTCTTTGTTGTAGTATCAATTATATTAATTTTCATACTGGGCAGAGGGGGGAGTAAGTTATAAATTCCGTTAT
TAAAATAGTCAAATGTTGTTCTGTACCAATACTGTAACCGCACGTTCAATAACTATTTATTATTATTCATAAAAATCCTT
TAAAAAGCACGTTTAATATTCACTCCCTCTGTTGTTGTAATCCTTGCTATTTTCAATATCTCAAAAATATTTGTTATCAA
AACTTTTTTCGTCAGTTTTTCTCTTTTTCTCTTACAAATTTAAGATGATGGCCCGTCACTCTCTGTGATCAAATTGGGAT
GTGGATGCTGGAGACCCCCCACGGAGCGATGGAGCTTGGAAGGAATCGTTGGATTTTGCCTAGAAACTAAAAGCCTGGCC
CTCCAGAGTCCTGGGAGTCCGAGCTTTCCGCTTTCAAGGAATCGCTTTGTTGACCATTGAGGACAGAGCACTGTGGACAA
GGAGACAGGACAAGCTCTTTGAGGACAGATCACTGTGGACAAGGAGACGGGACAAGCTCTTTGAGGACAGAGCACTGTGG
ACAAGGAGACAGGACAAATCACTGGACAAGGAGACAGGACAAATCACTGTGGACAAGGAGACAGGACAAATCACTGTGGA
CAAGGAGACAGGACAAATCACTGTGGACAAGGAGACAGGACAAATCACTGTGGACAGGAACACATAGGACAATGTCTTTT
AGGACCGATCACTGTGGTCAAGGACACTGAGGACAAGACATTGTGTGCAAGAGGAAATTCATCTTTATCCGGTGAGTTTA
CATAAAAATTTGTACCCAAATATTCGCCACAATTTATTTATTATTCTCTTCTGTTTCTAAACTGACTGGTTTTCTTTTAG
TGGTAACTAACGTTTTTAAGTTTTAAACAGTTTTAATTTGTACTACGATGAAAATAACAATAAATATGTAAAACGCTACC
AACGATTACAGTTAATACGACTCCCTGTCAGTTATGCGGCATAGATAA