>Mlig011373.g4 {REF} Mlig011373.g4 {Length: 1665} {Pfam: EF-1 guanine nucleotide exchange domain [PF00736.19, score=122.4]; Eukaryotic elongation factor 1 beta central acidic region [PF10587.9, score=49.9]; Glutathione S-transferase, C-terminal domain [PF13410.6, score=19.4]} {Human: ENSG00000114942, EEF1B2, eukaryotic translation elongation factor 1 beta 2, [RH, Score=263, Expect=2e-89]; ENSG00000283391, EEF1B2, eukaryotic translation elongation factor 1 beta 2, [RH, Score=263, Expect=2e-89]} {Mouse: ENSMUSG00000025967, Eef1b2, eukaryotic translation elongation factor 1 beta 2, [RH, Score=265, Expect=2e-90]} {Dmel: FBgn0028737, eEF1beta, eukaryotic translation elongation factor 1 beta, [RH, Score=227, Expect=2e-75]} {Celegans: WBGene00018846, eef-1B.1, Probable elongation factor 1-beta/1-delta 1, [RH, Score=174, Expect=9e-55]} {Smed: dd_Smed_v6_206_0_1, dd_Smed_v6_206_0_1, [RH, Score=286, Expect=3e-99]} {RNA1509_1199, RNA1509_126, RNA1509_3016, RNA1509_48210}
TATACTTGTTTGAATCTGCTACTCGTTATTTTTTACTGAATTTCTAAAATCTTAAATAGTTAGCATTAATAATTAGCATA
CATAGAGCTGTATCCCTTAAAAAAGCCTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAAGTTGGCTCAGGCAAGAAGCC
TGTTTGGCCAGTATATTTCTGTGTATTTAAGATATTTTAGCATTAGTTGTTTAATTACGATTAAGTTCAAAAGGTTAAAT
TTGTTCAAAAGGTTAAATTTTTACACGAGTTACGATATTTGTAAAATTATTAAGGTATTTGAAAGAGCGTTTTTTGTAAA
AAGATCATGTAGTATTTTGCAAGCGCGCAATATTTCAAAGCGTGAAAAACGAACGAAAAATGAACAAAAACGAACTTCGA
AAGAACTTTACGTTTAGCGAATAACGACGATTTAAAATACCGAACAATTTTTTAGTTACCGTTTTAAAATTGCTACTACG
TTAAAATTAAATTATTATAACAAATACAATACCAAACAGAGTAAAAAACGAAATAACTCAAAAAAATATTTTTTCTGAAA
GCAGAAAGTGTACCTTTAAGATACGCGCGCTGTTAAAAGCGTTTTTTTGTATAAAAATTTTAAGCTGTTTAAATTACAAA
AAAATCGCAGCACTTTTTCTTCACTATCGATCTATTTTATGGCTAGACATTAATAATAGGGCCTAACAGTGTTATTTCTT
ATTATTTAATATTGTGTGCATCGTGCATTTGGGTTGTGCTTTCTTAAGTTTAATATTTTTGTCTGGCGGAAAAAGAATGT
CTTTCGGAGATCTTAAAACTGAGGGGGCTGTTCAGAAACTTAATGCCTACCTAGCTGACAAAAGCTACATTGAAGGCTAC
CAGCCAACTGCAGCCGATGTCGCCGTGTTCGACGCCCTCTCCGGCGCGCCAAAAGACTCGCTGAATCACGCGCTCCGCTG
GTACAAGCACATCGCCTCCTACTCCAAGGCTGAGCGGTCCGGCTTCCCTGGCGACAAGTCCAAGAACGCCGCGGCGCCTG
CCGCCAACGATGACGACGACGACGTTGACCTGTTTGGTAGCGACGATGAGAACGACGCCGAAGCTGAGCGCATCAAGCAG
GAGCGCCTGCAAGCCTACCAGGAGAAGAAGGCCAAGAAGCCCGCCCTCGTTGCCAAGAGCAGCATCGTGCTAGACGTGAA
GCCGTGGGACGATGAGACTGACATGGCGGAGATGGAGCGCTGCGTTCGCAGCATCGCCACCGACGGCCTCCTGTGGGGCG
CCAGCAAGCTGGTGCCGGTTGGCTACGGCATCAAGAAGCTGCAGATTGGCTGCGTTGTTGAAGACGACAAAGTTGGCACC
GACTTCCTAGAGGAGGAGATCACCAAGTTCGAAGACTTGGTCCAATCTGTGGACGTGGCCGCTTTCCAGAAGATCTGAGC
GAGTCACCTTAGCCCTAGGAGACTGTGCTTTTGTTCTCAAGTTATTCTTGGCAATCTAAAAAATCAAATAATTATTCATA
AAAATAAACTGTCAGCGACCAAATTTATGCGAATGGTGACAGGCCAATCACTGCCAGATTGATGCATGCTGCCGCTTACA
GTGGACACGACAGCTTTGTTGGACTTTAAAATGGATAAATTTAAGTGCCTATCGATGCGCTTTGGT