>Mlig009776.g5 {REF} Mlig009776.g5 {Length: 2218} {Pfam: KH domain [PF00013.29, score=30.1]} {Human: ENSG00000112232, KHDRBS2, KH RNA binding domain containing, signal transduction associated 2, [Score=125, Expect=1e-32]; ENSG00000131773, KHDRBS3, KH RNA binding domain containing, signal transduction associated 3, [Score=123, Expect=8e-32]; ENSG00000121774, KHDRBS1, KH RNA binding domain containing, signal transduction associated 1, [Score=119, Expect=6e-30]} {Mouse: ENSMUSG00000026058, Khdrbs2, KH domain containing, RNA binding, signal transduction associated 2, [Score=125, Expect=5e-33]; ENSMUSG00000022332, Khdrbs3, KH domain containing, RNA binding, signal transduction associated 3, [Score=123, Expect=6e-32]; ENSMUSG00000028790, Khdrbs1, KH domain containing, RNA binding, signal transduction associated 1, [Score=120, Expect=2e-30]} {Dmel: FBgn0022987, qkr54B, quaking related 54B, [RH, Score=124, Expect=5e-32]} {Celegans: WBGene00006423, asd-2, RNA-binding protein asd-2, [Score=86.7, Expect=4e-19]} {Smed: dd_Smed_v6_294_0_1, dd_Smed_v6_294_0_1, [RH, Score=160, Expect=8e-47]} {RNA1509_1718}
CAGAAACTAAAGTGTCTGTAGAAGTGTCTGAATAAGTGTCGGCGAATGTTTAATACGTGTCCCATACTCGAAGCTCGCTT
AAAAGAATACGTAATTTCTAGGATTAGGTATTGGTACATTACACATTCAGTTTAATTTGCATAAATAGGGCTTCTTACTT
GCTTATTTGGTTTAAAAACCTAATTTTAGTAAATACCAAAGACCAAACTTATAAGATATGACTGAACACGATGATGGCCA
GGGAGAGTTGGACATGAGCCACGGTGGAGTTGGTGGCTTTCGATCTCAGCGTGATCAACAAAGACAGCAAGAAATAGAAT
ACTACGAAGAAGAGCTCTCCAGACTTGATGACAGCTATCCTTGTGCTCGCAATGCTTTGGAACTTGAGATCCACCGAGTG
CGTGGCGGCGTCATGGACATGATCGACGTGGTCAACAACCGCAAGTGCAAAGTTCGCTGCCGTATCGCCATACCGCAGGA
CAATTTCCCCGGCTTCAACTTTGTTGGCAAACTGCTGGGCTCAGGCGGCAGCACGCTGAAGAAGCTGCAGGAGGACTGCA
ACGTCAAGATGGCCATCCTTGGCCGCGGCTCGATGCGCGATCCGCAGAAAGAGCAGGAAGCCTTCGAAAGCGGCGACCCG
AAGTATCAGCACCTGAAGCAGGCCTTGCACCTGCAGATTGACTGCGTAGACGCGCCCGAGGAGGCCTACTATCGTATCAG
CCGGGCGGTCTACGAAGCCAAGAACATCATGATCCCGGATCCCAGCGAGCTGGCCGCTGCCGCAGCTGCTTCTGGCTACG
GCGCCCCGGGACCTTTCCCTCCTGGCCGCGGCGGCTTTCCAGGCGGCGGCGGTGGACCTCGTGGAGGTCGCGGTGGACGC
GGTCGCGGCGGCCGGGGCGGCGGGGCTCCTCACGTTCCGGCCGACTTTGACGGCTACGGCGGCGGCGGCGGTGGCTTTGA
TGGAGAGGCCGGCGGCTACCGAGGCGGTCGCGGTGGCGGCGGCGGTCGCGGGCATCGCGGCGACTTCAGAGGCGGCTCTC
GCGGCGGCGGCTCTCGAGGCGGTCGTGGCGGCTTCGGCGGCGGCGGTGGCGACAATGGGCACAGCTTTGGTCAGGATTAT
GGTCAGTCGTTTGGCGGCGGCAAGGCGCCACCGTCGCGGGGTCGCGGCGGCCCCGCCCCGCGCCGCGGCAGCCACCCATA
TGGCCGCGGCATGTGAACCCGGTCTCAGGCAGTCTAATAATACACCAAGCATATAATACTTTAATAATTAATTCATATAG
TCATCGTAAAGACTGAAAGCATGAGCTGAAACACAGCAAAGCTTGAACTTTTAATATTTTTATACATATGAACTCATCAA
TTTTAAATTTATAGTTCCAGCTGATACAATTTATCCAGTGAAAAAGAAATCTAAGTAACTACTAAATTAAAAAAAACATT
CTGCATTACAATTTGTTGTTAAAATGAAAGCTTGGGCTCATCAACCCTTAAAATGTTGTGCATATTTATTTGCCCATGCT
CGCTTGTTGAAAATTTATAAAATTCACGCAGTTAGTTTTCTAAATTACGTTGTTTTAGGGACAATAATAATATTCGCTAA
TATTGACAAAACTAAACAATTTCTAAAAACTTTCTAATTAATTAATCTGTTCTTTTCCTCTCGTTTTAAGTCTACAAAGT
TATTTGATTGTATTTGACTGAAAATGCAGTTTTATGGCAGGTTTTTTAACCTTTAGTTAGTAAGTGTTTGCTTCTGTTTA
GCTGTCTTAATTAACTGTTATTTAGAAACAGTTAGTGTAATTTTAACAGACGCCAGGACGAAGAAAGCGTTAGTAAAGAT
GCATTGATAGTTGACAACCGGCACCAACAGGAATTTAGGTTTTACTTTAAACAAAAATATTTTCCAAACGAATTTATGGC
TGCTTCTGTTTGTAGTAGCATGTTCTATAATATCATGGGCTGTTAAACATGCAATCGATAATTTTTCTCCATTCAACAGC
AAGCACTGAATATGTAGTACGCGTAATTATTTATTTTAGTCAAAAGCGCAAACTAAATTTTAAATAAAATAACTATTTTC
CAACTTTTGCATTATTAAAAACACGACAACATGCGTTCAACTTAACCTATTCGCGGTAAAAAACCAAATACATAAAACAT
GATAAAAGCGATTCTTTGTTTTATTAAACAAACTGCTTACTATTACGTTTCGTTGTAAT